View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8418_low_8 (Length: 237)
Name: NF8418_low_8
Description: NF8418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8418_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 45 - 219
Target Start/End: Complemental strand, 17885506 - 17885332
Alignment:
| Q |
45 |
ctttcgcattttgaatttctaggtttcttcttcctgcattatccatgctgagagcttcatctaaatccgtccaaccacacggtcatcataccggagttcg |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17885506 |
ctttcgcattttgaatttctaggtttcttcttcctgcattatccatgctgagagcttcatctaaatccgtccaaccacacggtcatcataccggagttcg |
17885407 |
T |
 |
| Q |
145 |
tatcattgttgccggagaaaaatgtactggtaaatccaccctcattcgcgctgcggcctccaacaaatttgagaa |
219 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17885406 |
tatcgttgttgccggagaaaaatgtaccggtaaatccaccctcattcgcgctgcggcctccaacaaatttgagaa |
17885332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University