View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8422_high_2 (Length: 252)
Name: NF8422_high_2
Description: NF8422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8422_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 172 - 240
Target Start/End: Original strand, 29239103 - 29239171
Alignment:
| Q |
172 |
gaatataaaaagtaatatatattgcttgattgttgatcctcttctctttaaattttctttctctttcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
29239103 |
gaatataaaaagtaatatatattgcttgattgttgaccctcttctctttaagttttctttctctttcat |
29239171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 29238977 - 29239024
Alignment:
| Q |
1 |
aaagggacgggaattaggtagccttggcctcggtggtggtagtaatta |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29238977 |
aaagggacgggaattaggtagccttggccttggtggtggtagtaatta |
29239024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University