View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8422_low_3 (Length: 252)

Name: NF8422_low_3
Description: NF8422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8422_low_3
NF8422_low_3
[»] chr3 (2 HSPs)
chr3 (172-240)||(29239103-29239171)
chr3 (1-48)||(29238977-29239024)


Alignment Details
Target: chr3 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 172 - 240
Target Start/End: Original strand, 29239103 - 29239171
Alignment:
172 gaatataaaaagtaatatatattgcttgattgttgatcctcttctctttaaattttctttctctttcat 240  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||    
29239103 gaatataaaaagtaatatatattgcttgattgttgaccctcttctctttaagttttctttctctttcat 29239171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 29238977 - 29239024
Alignment:
1 aaagggacgggaattaggtagccttggcctcggtggtggtagtaatta 48  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||    
29238977 aaagggacgggaattaggtagccttggccttggtggtggtagtaatta 29239024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University