View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8422_low_4 (Length: 239)
Name: NF8422_low_4
Description: NF8422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8422_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 66 - 221
Target Start/End: Complemental strand, 43104213 - 43104056
Alignment:
| Q |
66 |
ataaaatcacatcttatcatatagatatttgtaannnnnnnn--ctttctattgacacatttctccccctcgaatgacaaacagggaaaggtgatggaaa |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43104213 |
ataaaatcacatcttatcatatagatatttgtaattttttttttctttctattgacacatttctccccctcgaatgacaaacagggaaaggtgatggaaa |
43104114 |
T |
|
| Q |
164 |
tgtttcaaaattcacttgatgatgaaggaaagaagaaaatcatctacttaggagatgg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43104113 |
tgtttcaaaattcacttgatgatgaaggaaagaagaaaatcatctacttaggagatgg |
43104056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 3 - 68
Target Start/End: Complemental strand, 43104313 - 43104244
Alignment:
| Q |
3 |
tatgtagagctagagcagcttctatattgagttaatatac----ttttaactttataaaataaaaatata |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43104313 |
tatgtagagctagagcagcttctatattgagttaatatactttgttttaactttataaaataaaaatata |
43104244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 169 - 221
Target Start/End: Complemental strand, 43107334 - 43107282
Alignment:
| Q |
169 |
caaaattcacttgatgatgaaggaaagaagaaaatcatctacttaggagatgg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||| |||||| |
|
|
| T |
43107334 |
caaaattcacttgatgatgaaggaaagaagaaattcatctacctagaagatgg |
43107282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University