View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8423_high_7 (Length: 262)
Name: NF8423_high_7
Description: NF8423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8423_high_7 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 24 - 262
Target Start/End: Original strand, 29189690 - 29189928
Alignment:
| Q |
24 |
cttcatagaaactcagtatatgtttgcttattttgtctctatggtgtttctacagctgagtcttggtttgcagctgatacatcaagtggatatcttgaag |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29189690 |
cttcatagaaactcagtatatgtttgcttattttgtctctatggtgtttctacagctgagtcttggtttgcagctgatacatctagtggatatcttgaag |
29189789 |
T |
|
| Q |
124 |
atgcaatcaatggctgggatatttggtgcaagcaacataacttaccaacctactctcaagattcaaaggttaaactaacaactatgcatggtttcatgtt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29189790 |
atgcaatcaatggctgggatatttggtgcaagcaacataacttaccaacctactctcaagatcaaaaggttaaactaacaactatgcttggtttcatgtt |
29189889 |
T |
|
| Q |
224 |
ctatacatttgcttaattgttatttcatagttttatttg |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29189890 |
ctatacatttgcttaattgttatttcatagttttatttg |
29189928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University