View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8423_low_7 (Length: 340)
Name: NF8423_low_7
Description: NF8423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8423_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 53350258 - 53350451
Alignment:
| Q |
1 |
tctcatgcttcttacattgaaatttagaatacacctacacttttactcataatcaaacactaatgttcaatttccttcatgtctccactgctagatagca |
100 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| ||||||||| |
|
|
| T |
53350258 |
tctcaggctacttacattgaaatttagaatacaactacacttttactcataatcaaacactaatgttcaatttacttcatgtgtccactgatagatagca |
53350357 |
T |
 |
| Q |
101 |
ctgaattaaacatagcactgcaatcatagtttgatgcaggtttaggagtgcatcccctccccaccaagtaattatatagcatgtacatattctc |
194 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
53350358 |
ctaaattaaacatagcactgcaatcatagtttgatgcaggttttggagtgcatcccctccccaccgagtaattatatagcatgtacatactctc |
53350451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 83; Significance: 3e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 96 - 194
Target Start/End: Original strand, 22003651 - 22003749
Alignment:
| Q |
96 |
tagcactgaattaaacatagcactgcaatcatagtttgatgcaggtttaggagtgcatcccctccccaccaagtaattatatagcatgtacatattctc |
194 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
22003651 |
tagcactaaattaaacatagcactgcaatcatagtttgatgcaggttttggagtgcatcccctccccaccgagtaattatatagcatgtacatactctc |
22003749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University