View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8426_low_18 (Length: 228)
Name: NF8426_low_18
Description: NF8426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8426_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 172 - 212
Target Start/End: Complemental strand, 37304926 - 37304886
Alignment:
| Q |
172 |
atgtttgccagacacaaaatcattctcatcataatcaaaag |
212 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37304926 |
atgtttgccaaacacaaaatcattctcatcataatcaaaag |
37304886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University