View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8426_low_18 (Length: 228)

Name: NF8426_low_18
Description: NF8426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8426_low_18
NF8426_low_18
[»] chr5 (1 HSPs)
chr5 (172-212)||(37304886-37304926)


Alignment Details
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 172 - 212
Target Start/End: Complemental strand, 37304926 - 37304886
Alignment:
172 atgtttgccagacacaaaatcattctcatcataatcaaaag 212  Q
    |||||||||| ||||||||||||||||||||||||||||||    
37304926 atgtttgccaaacacaaaatcattctcatcataatcaaaag 37304886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University