View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8427_high_20 (Length: 261)
Name: NF8427_high_20
Description: NF8427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8427_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 24 - 254
Target Start/End: Original strand, 19423300 - 19423530
Alignment:
| Q |
24 |
aaataccgaaattaacaacggtagcttaacttcgagccctatttcgtatccatcaactgtgttttgaggatttctgcactcacttcctcgacatttggaa |
123 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19423300 |
aaataccaaaattaacaacggtagcttaacttcgtgcactatttcgtatccatcaactgtgttttgaggatctctgcactcacttcctcgacatttggaa |
19423399 |
T |
 |
| Q |
124 |
acaagtgaccagcaccttgcaattcatggtattgaatccacggaagtttttcaacaatatatcgttgcagtgtagcggggactagcttatcatcagcacc |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19423400 |
acaagtgaccagcaccttgcaattcatggtattgaatccacggaagtttttgaacaatatatcgttgcagcgtagcggggactagcttatcatcagcacc |
19423499 |
T |
 |
| Q |
224 |
ttgccatagatgaactttgatagtattatct |
254 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |
|
|
| T |
19423500 |
ttgccatagatgaactttgattgtattatct |
19423530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University