View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8427_high_21 (Length: 255)
Name: NF8427_high_21
Description: NF8427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8427_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 56 - 241
Target Start/End: Original strand, 6706155 - 6706337
Alignment:
| Q |
56 |
ctttgaggttgaaatggtttctccttcgggttcgggttcaagttcgttgtgatgagtagtggtggtgatagtgttaagtcttgatgatgatgattcctct |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
6706155 |
ctttgaggttgaaatggtttctccttcgggttcgggttcaagttcgttgtgatgagtagtggtggtgatagtgttgagtcttgat---gatgattcctct |
6706251 |
T |
 |
| Q |
156 |
tcttcagccattggcctcacaaaaaattcagatcttaaacaattattgtaggtgctatagtcttcaacaaatggaaattggttcat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6706252 |
tcttcagccattggcctcacaaaaaattcagatcttaaacaattattgtaggtgctatagtcttcaacaaattgaaattggttcat |
6706337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University