View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8427_high_27 (Length: 205)
Name: NF8427_high_27
Description: NF8427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8427_high_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 14 - 181
Target Start/End: Complemental strand, 32994259 - 32994092
Alignment:
| Q |
14 |
aagcagagaggataccgttaacagctagaatgacatatatgttagtgtacatgtaacatgtgaatagagatgacgaggttccttaggacaaaagattcaa |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32994259 |
aagcaaagaggataccgttaacagctagaatgacatatatgttagtgtacatgtaacatgtgaatagagatgacgaggttccttaggacaaaagattcaa |
32994160 |
T |
|
| Q |
114 |
gaggtaatgaagaaaaacctgtaattgttgtcacagaaacagtgtgtaagtgtaattattattattat |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32994159 |
gaggtaatgaagaaaaacctgtaattgttgtcacagaaacagtgtgtaagtgtaattattattattat |
32994092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University