View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8427_low_28 (Length: 212)
Name: NF8427_low_28
Description: NF8427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8427_low_28 |
 | |
|
| [»] scaffold0274 (2 HSPs) |
| | |
|
| [»] scaffold0271 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 66 - 180
Target Start/End: Original strand, 41429859 - 41429973
Alignment:
| Q |
66 |
gtcacttttggtgtgtgccttacaccacgaacaaaaccttcaaacttttcacactcactaactaactcttcccctcaaagggtttgatttgattaaggtt |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41429859 |
gtcacttttggtgtgtgccttacaccacgaacaaaaccttcaaacttttcacactaactaactaactcttcccctcaaagggtttgatttgattaaggtt |
41429958 |
T |
|
| Q |
166 |
tttgcttgatggacc |
180 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41429959 |
tttgcttgatggacc |
41429973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 14 - 65
Target Start/End: Original strand, 41424846 - 41424897
Alignment:
| Q |
14 |
caaatatatcaattgtttcgtaaattccgttactcactcttgtcactcgctc |
65 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41424846 |
caaatatatcaattatttcgtaaattccgttactcactcttgtcactcgctc |
41424897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0274 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: scaffold0274
Description:
Target: scaffold0274; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 66 - 180
Target Start/End: Complemental strand, 15028 - 14909
Alignment:
| Q |
66 |
gtcacttttggtgtgtgccttaca----ccacgaacaaaaccttcaaacttttcacactcactaactaa-ctcttcccctcaaagggtttgatttgatta |
160 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15028 |
gtcacttttggtgtgtgccttacagacaccacgaacaaaaccttcaaacttttcacactcactaactaaactcttcccctcaaagggtttgatttgatta |
14929 |
T |
|
| Q |
161 |
aggtttttgcttgatggacc |
180 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
14928 |
aggtttttgcttgatggacc |
14909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0274; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 15 - 65
Target Start/End: Complemental strand, 19028 - 18978
Alignment:
| Q |
15 |
aaatatatcaattgtttcgtaaattccgttactcactcttgtcactcgctc |
65 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19028 |
aaatatatcaattatttcgtaaattccgttactcactcttgtcactcgctc |
18978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0271 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: scaffold0271
Description:
Target: scaffold0271; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 15 - 65
Target Start/End: Complemental strand, 5331 - 5281
Alignment:
| Q |
15 |
aaatatatcaattgtttcgtaaattccgttactcactcttgtcactcgctc |
65 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5331 |
aaatatatcaattatttcgtaaattccgttactcactcttgtcactcgctc |
5281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University