View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8428_low_10 (Length: 300)
Name: NF8428_low_10
Description: NF8428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8428_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 290
Target Start/End: Original strand, 51091122 - 51091394
Alignment:
| Q |
19 |
gatttggcatgcaactatttgggtcctttggcaagttaggaatcacataatttcccgaaacgatgtgaaatatgtggaagatctagtggaggaaattatg |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |||| || || ||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
51091122 |
gatttggcatgcaactattttggtcctttggcaagttaggaatcacattatttttcggaatgatgtgaaatatgtggaagatctagtgaaggaaactatg |
51091221 |
T |
 |
| Q |
119 |
gtgttgtctt-ggccttgaattttgagtaggttaaatatccctccttgtatgtattacgagtggagctggaatccgcaagtttgtcttataaggtagggg |
217 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
51091222 |
gtgttgtctttggcattgaattttgagtaggttaaatatccctccttgtatgcattgcgagtggagttggaatccgcaagtttgtcttatgaggtagggg |
51091321 |
T |
 |
| Q |
218 |
tgggttctgataaggggtggtgctgctacaggtttttagctgcactcaaaaatctgttgttctgggctctctg |
290 |
Q |
| |
|
||||||||||| ||||| ||||||| |||||||||||||||||||||| ||||||| ||||||||||| |||| |
|
|
| T |
51091322 |
tgggttctgatgaggggaggtgctgttacaggtttttagctgcactcagaaatctgctgttctgggctttctg |
51091394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 102
Target Start/End: Complemental strand, 9359477 - 9359395
Alignment:
| Q |
20 |
atttggcatgcaactatttgggtcctttggcaagttaggaatcacataatttcccgaaacgatgtgaaatatgtggaagatct |
102 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| || || | |||||| || ||||| ||||||| ||||| |
|
|
| T |
9359477 |
atttggcatgcaactatttgggctatttggcaagctaggaatcatatgatcttccgaaatgaggtgaagcatgtggatgatct |
9359395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University