View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8430_high_3 (Length: 242)
Name: NF8430_high_3
Description: NF8430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8430_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 147 - 232
Target Start/End: Original strand, 34420162 - 34420247
Alignment:
| Q |
147 |
tcttaaatgtaagaattgttcttctgttggtctagtatttattgtgaaattgttgttcaggaaactgaggagatgattgctgatgt |
232 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34420162 |
tcttaaatgtaagaattgttctaatgttggtctagtatttattgtgaaattgttgttcaggaaactgaggagctgattgctgatgt |
34420247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 160 - 232
Target Start/End: Original strand, 34424311 - 34424383
Alignment:
| Q |
160 |
aattgttcttctgttggtctagtatttattgtgaaattgttgttcaggaaactgaggagatgattgctgatgt |
232 |
Q |
| |
|
|||||||||||| |||||| |||||||| | |||||||||||||||||||||||||||| || |||| ||||| |
|
|
| T |
34424311 |
aattgttcttctcttggtcaagtatttactatgaaattgttgttcaggaaactgaggaggtggttgcagatgt |
34424383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University