View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8430_low_5 (Length: 242)

Name: NF8430_low_5
Description: NF8430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8430_low_5
NF8430_low_5
[»] chr1 (2 HSPs)
chr1 (147-232)||(34420162-34420247)
chr1 (160-232)||(34424311-34424383)


Alignment Details
Target: chr1 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 147 - 232
Target Start/End: Original strand, 34420162 - 34420247
Alignment:
147 tcttaaatgtaagaattgttcttctgttggtctagtatttattgtgaaattgttgttcaggaaactgaggagatgattgctgatgt 232  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
34420162 tcttaaatgtaagaattgttctaatgttggtctagtatttattgtgaaattgttgttcaggaaactgaggagctgattgctgatgt 34420247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 160 - 232
Target Start/End: Original strand, 34424311 - 34424383
Alignment:
160 aattgttcttctgttggtctagtatttattgtgaaattgttgttcaggaaactgaggagatgattgctgatgt 232  Q
    |||||||||||| |||||| |||||||| | |||||||||||||||||||||||||||| || |||| |||||    
34424311 aattgttcttctcttggtcaagtatttactatgaaattgttgttcaggaaactgaggaggtggttgcagatgt 34424383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University