View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8431_high_14 (Length: 222)
Name: NF8431_high_14
Description: NF8431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8431_high_14 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 2 - 222
Target Start/End: Complemental strand, 30948754 - 30948533
Alignment:
| Q |
2 |
aataacattagttattcagactgtttttaaagaatgttgagaagaatgagttaagtctttcaaagttaaatttcatataccttgtgtaagg-ttgccacc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30948754 |
aataacattagttattcagactgtttttaaagaatgttgagaagaatgagttaagtctttcaaagttaaatttcatataccttgtgtaagggttgccacc |
30948655 |
T |
 |
| Q |
101 |
tagcaaaagggtgatgcaaggaattgtcccatccctacaaagaatgagttcagtctagcttaaaagtttgattatctctataagactgaaacttcagatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30948654 |
tagcaaaagggtgatgcaaggaattgtcccatccctacaaagaatgagttcagtctagcttaaaagtttgattatctctataagactgaaacttcagatt |
30948555 |
T |
 |
| Q |
201 |
gaagacgaccatgtcggtatca |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30948554 |
gaagacgaccatgtcggtatca |
30948533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University