View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8431_low_11 (Length: 382)
Name: NF8431_low_11
Description: NF8431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8431_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 3 - 373
Target Start/End: Original strand, 45305703 - 45306066
Alignment:
| Q |
3 |
acaaaaaccataaccattgttaattagttgaggag--ggagattgatgactgaatagaatgaactcttcttctaggtcacatgaattgcaagagagggag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45305703 |
acaaaaaccataaccattgttaattagttgaggagatggagattgatgactgaatagaatgaactcttcttctaggtcacatgaattgcaagagag---- |
45305798 |
T |
 |
| Q |
101 |
agagaatggtataatattgttggatgaatatgggacaaaagatagagatgaggttgactaggctttaagnnnnnnnnnnnnnnnnagcgtggaattctgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45305799 |
--agaatggtataatattgttggatgaatatgggacaaaagat-gagatgaggttgactaggctttaaggagggagagagaga--agcgtggaattctgg |
45305893 |
T |
 |
| Q |
201 |
gagattgatttgttattgggagtagagaatgaaaaacgacgtgacgatgatgagggttatcatgagcctcatcactcatttattgttctcttttacgtct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45305894 |
gagattgatttgttattgggagtagagaatgaaaaacgacgtgacgatgatgagggttatcatgagcctcatcactcatttattgttctcttttacgtct |
45305993 |
T |
 |
| Q |
301 |
cgtgcctttcacactaattctcaatccgaactgctccctctttcacccttttctttgtctattttgatgtcca |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45305994 |
cgtgcctttcacactaattctcaatccgaactgctccctctttcacccttttctttgtctattttgctgtcca |
45306066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University