View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8431_low_12 (Length: 367)
Name: NF8431_low_12
Description: NF8431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8431_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 50 - 362
Target Start/End: Complemental strand, 7926090 - 7925780
Alignment:
| Q |
50 |
ggaatttgttgcaggctaagagagataacacgcagccctgcttcccatgcaatggatctggagctcgtaagtatcattttttctctcttcaatttcatca |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7926090 |
ggaatttgttgcaggctaagagagataacacgcagccctgcttcccatgcaatggatctggagctcgtaagtatcattttttttctcttcaatttcatca |
7925991 |
T |
|
| Q |
150 |
tcacactttatacttttatgaatggagcattatggaggtagttcacaagttattgttaatttggagtaatttttacttttagtacataactattgttgct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7925990 |
tcacactttatacttttatgaatggagcattatggaggtagttcacaagttattgttaatttggagtaatttttacttttagtacataactattgttgct |
7925891 |
T |
|
| Q |
250 |
gctgtagtgtaatgtgcaaggccaacgtatagattagtannnnnnnnnncatccgagtttaaattggcttttagttcattggaatttctcaattaaaata |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7925890 |
gctgtagtgtaatgtgcaaggccaacgtatagattagt--tttttttttcatccgagtttaaattggcttttagttcattggaatttctcaattaaaata |
7925793 |
T |
|
| Q |
350 |
tgtctatgcttct |
362 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
7925792 |
tgtctatgattct |
7925780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University