View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8431_low_16 (Length: 292)
Name: NF8431_low_16
Description: NF8431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8431_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 30 - 281
Target Start/End: Complemental strand, 46125993 - 46125745
Alignment:
| Q |
30 |
cacagagtcagtccagtagagcctgtcaggtataacatcaacaggaagggtgactctcaaaattctggaggcaacaacattatctttttgaattatgtac |
129 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46125993 |
cacagagtcagtccatcagagcctgtcaggtataacatcaacaggaagggtgactctcaaaattctggaggcaacaacattatctttttgaattatgtac |
46125894 |
T |
|
| Q |
130 |
tcaggcaagcaccattatttatttataatacttataaagtactattagcttcgaaaattaacaatgtttggtgtccatgttttaagaaagggactagact |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46125893 |
tcaggcaagcaccattatttatttataatacttataaag---tattagcttcgaaaataaacaatgtttggtgtccatgttttaagaaagggactagact |
46125797 |
T |
|
| Q |
230 |
cacaaaacatgcaacatgtgacctgagagatatgtccgacgtatttttagta |
281 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46125796 |
cacaaaacgtgcaacatgtgacctgagagatatgtccgacgtatttttagta |
46125745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University