View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8431_low_4 (Length: 573)
Name: NF8431_low_4
Description: NF8431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8431_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-104; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-104
Query Start/End: Original strand, 323 - 554
Target Start/End: Original strand, 32702633 - 32702865
Alignment:
| Q |
323 |
agggagcctaccattgttttgtctaaatagtacccactacaattttgtgaattaggtgttattcaactatttaaaatgaataaagtgatattgtttnnnn |
422 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32702633 |
agggagcctaccattgttttgtctaaatagtacccactccaattttgtgaattaggtgttattcaactatttaaaatgaataaagtgatattgtttaaaa |
32702732 |
T |
|
| Q |
423 |
nnnn-ctttctctttgctcatattgcgccaatattgttgagtggattctctactgagatttttcgtaaagtttcactcttttttcttttgccttcatttg |
521 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32702733 |
aaaaactttctctttgctcatattgcgccaatattgttgagtggattctctactgagatttttcgtaaagtttcactcttttttcttttgccttcatttg |
32702832 |
T |
|
| Q |
522 |
tttagaaaaacaaaacgaaatcaaaatgcctga |
554 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
32702833 |
tttagtaaaacaaaacgaaatcaaaatgcctga |
32702865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 19 - 156
Target Start/End: Original strand, 32702345 - 32702482
Alignment:
| Q |
19 |
tgttcatgggtaaaaaggaaataaaaagtgagagtagcgtttgaaatggaaaagaaagatcgcggaggggactttcgtcatgtatgtttgtttgatttgg |
118 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32702345 |
tgttcatgggtgaaaaggaaataaaaagtgagagtagcgtttgaaatggaaaagaaagatcgcggaggggactttcgtcatgtatgtttgtttgttttgg |
32702444 |
T |
|
| Q |
119 |
aaactagattgttatggtttcgataactgaaggtgtac |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32702445 |
aaactagattgttatggtttcgataactgaaggtgtac |
32702482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 215 - 287
Target Start/End: Original strand, 32702541 - 32702610
Alignment:
| Q |
215 |
ggcgggggagccaattatgattattacatgcagcagggagcctggttaaggcggggagcctatttttgattta |
287 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| ||||||| ||||||||| ||| |||||| |
|
|
| T |
32702541 |
ggcgggggagccaattatgattattacat---gcagggagcctgcttaaggctgggagcctactttggattta |
32702610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 465 - 554
Target Start/End: Complemental strand, 35533625 - 35533535
Alignment:
| Q |
465 |
gattctctactgagatttttcgtaaagtttcactctttttt-cttttgccttcatttgtttagaaaaacaaaacgaaatcaaaatgcctga |
554 |
Q |
| |
|
||||||||| ||| ||| ||||| ||||||||||||||||| ||||| ||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
35533625 |
gattctctagtgaaattcttcgttaagtttcactctttttttctttttccttcatttgtttagaaaagcaaaacgaaatctaaatgcctga |
35533535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University