View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8433_high_12 (Length: 216)
Name: NF8433_high_12
Description: NF8433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8433_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 36995930 - 36995730
Alignment:
| Q |
1 |
tgttgaacttttatgcacttaacacattagcgataattcacccccttgaccccgggcgaactgattgttttggtaggttttttattatttnnnnnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36995930 |
tgttgaacttttatgcacttaacacattagcgataattcacccccttgaccccgggcgaactgattgttttggtaggttttttattatttaaaaaaaaaa |
36995831 |
T |
|
| Q |
101 |
nnn--gctttactattactaaccatttcatttgagtttattcagatcgatttcacttagtttgtaaggctcacccgggggatgtatttgatcttgagcgt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36995830 |
aaaaagctttactattactaaccatttcatttgagtttattcagatcgatttcacttagtttgtaaggctcacccgggggatgtatttgatcttgagcgt |
36995731 |
T |
|
| Q |
199 |
g |
199 |
Q |
| |
|
| |
|
|
| T |
36995730 |
g |
36995730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 2 - 83
Target Start/End: Complemental strand, 37005871 - 37005790
Alignment:
| Q |
2 |
gttgaacttttatgcacttaacacattagcgataattcacccccttgaccccgggcgaactgattgttttggtaggtttttt |
83 |
Q |
| |
|
||||||||||||||| || || |||||||||||||||||| ||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
37005871 |
gttgaacttttatgctctgtgcaaattagcgataattcacccacttgaccccgggcaaactgattgttttggtagttttttt |
37005790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 107 - 144
Target Start/End: Complemental strand, 37005760 - 37005723
Alignment:
| Q |
107 |
ttactattactaaccatttcatttgagtttattcagat |
144 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
37005760 |
ttactaatactaactatttcatttgagtttattcagat |
37005723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 1e-21; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 107 - 199
Target Start/End: Original strand, 13684404 - 13684496
Alignment:
| Q |
107 |
ttactattactaaccatttcatttgagtttattcagatcgatttcacttagtttgtaaggctcacccgggggatgtatttgatcttgagcgtg |
199 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||| |||| |||||||||| ||| |||| | |||||||| |||||||||||| |
|
|
| T |
13684404 |
ttactaatactaactatttcatttgagtttattcagatcgattccactcagtttgtaagactcgcccgcgatatgtatttcatcttgagcgtg |
13684496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 114 - 165
Target Start/End: Complemental strand, 22191953 - 22191902
Alignment:
| Q |
114 |
tactaaccatttcatttgagtttattcagatcgatttcacttagtttgtaag |
165 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||| |||| |||||||||| |
|
|
| T |
22191953 |
tactaactatttcatctgagtttattcagatcgattccactcagtttgtaag |
22191902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 2 - 81
Target Start/End: Original strand, 13684287 - 13684366
Alignment:
| Q |
2 |
gttgaacttttatgcacttaacacattagcgataattcacccccttgaccccgggcgaactgattgttttggtaggtttt |
81 |
Q |
| |
|
|||||| ||||||||||| | |||| |||||||||||||||||| | || | ||| ||||||||||| |||||||||| |
|
|
| T |
13684287 |
gttgaaattttatgcactgagcacagtagcgataattcacccccgtaactaccggctaactgattgttcaggtaggtttt |
13684366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 26648833 - 26648784
Alignment:
| Q |
1 |
tgttgaacttttatgcacttaacacattagcgataattcacccccttgac |
50 |
Q |
| |
|
||||||| ||||||| ||| |||||| |||||||||||||||||| |||| |
|
|
| T |
26648833 |
tgttgaaattttatgtactgaacacagtagcgataattcacccccatgac |
26648784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 122 - 199
Target Start/End: Complemental strand, 8598315 - 8598238
Alignment:
| Q |
122 |
atttcatttgagtttattcagatcgatttcacttagtttgtaaggctcacccgggggatgtatttgatcttgagcgtg |
199 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||| |||||||||| ||||||||||| |||||| |||| ||||||||| |
|
|
| T |
8598315 |
atttcatttgagtttaatcagatcgattccactcagtttgtaagactcacccggggtatgtatatgattttgagcgtg |
8598238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 9 - 83
Target Start/End: Complemental strand, 8598580 - 8598506
Alignment:
| Q |
9 |
ttttatgcacttaacacattagcgataattcacccccttgaccccgggcgaactgattgttttggtaggtttttt |
83 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||| ||||| || ||| || ||||| |||||||||||||||||| |
|
|
| T |
8598580 |
ttttatggactgaacacattagcgataattcactcccttcactccgagctaactgtatgttttggtaggtttttt |
8598506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University