View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8433_high_7 (Length: 280)
Name: NF8433_high_7
Description: NF8433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8433_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 271
Target Start/End: Complemental strand, 958962 - 958706
Alignment:
| Q |
18 |
aattgaggcacggggaactacccttagaaaaattccaatctctacactaaattctgaagtggggatcacaatgaaccatatggatcatattaactttaca |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
958962 |
aattgaggcacggggaactactcttagaaaaattccaatctctacactaaattctgaagtggggatcacaatgaaccatatggatcatattaactttaca |
958863 |
T |
 |
| Q |
118 |
tatagtttcatgtggtggcaatggtcaattattcttttttatctacaagtccatatatgagcttgttttaatatgtgaaagtgaaggggttgtgttgtgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
958862 |
tatagtttcatgtggtggcaatggtcaattattcttttttatctacaagtccatatatgagcttgttttaatatgtgaaagtgaaggggttgtgttgtgg |
958763 |
T |
 |
| Q |
218 |
caatgcatgcatcttcatttttaggttgat---tattcccatctttcttcttcatct |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
958762 |
caatgcatgcatcttcatttttaggttgattattattcccatctttcttcttcatct |
958706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 95 - 150
Target Start/End: Complemental strand, 966986 - 966929
Alignment:
| Q |
95 |
atatggatcatattaactttacata--tagtttcatgtggtggcaatggtcaattatt |
150 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||| | ||| ||||||||||||||| |
|
|
| T |
966986 |
atatggatcgtattaactttacataattagtttcatatcgtgacaatggtcaattatt |
966929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University