View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8433_low_11 (Length: 263)
Name: NF8433_low_11
Description: NF8433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8433_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 16 - 253
Target Start/End: Complemental strand, 24306652 - 24306415
Alignment:
| Q |
16 |
cataattctgctggtataattgactactctaaaggaatgggacccttgttaattgttaaagagaaggaccaaaatgaagtaatagtctcaaaggtggcag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24306652 |
cataattctgctggtataattgactactctaaaggaatgggacccttgttaattgttaaagagaaggaccaaaatgaagtaatagtctcaaaggtggcag |
24306553 |
T |
 |
| Q |
116 |
ggtttaagcatgccatgccccattatttttaagcaacaatttggctgttccccactttaaaatcatccctatggcttagaatgaggtattaccggacatg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24306552 |
ggtttaagcatgccatgccccattatttttaagcaacaatttggctgttccccactttaaaatcatccctatggcttagaatgaggtataaccggacatg |
24306453 |
T |
 |
| Q |
216 |
gtcaggtccattcattattcctcttgtttgtctctctg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24306452 |
gtcaggtccattcattattcctcttgtttgtctttctg |
24306415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University