View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8435_high_1 (Length: 425)

Name: NF8435_high_1
Description: NF8435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8435_high_1
NF8435_high_1
[»] chr6 (1 HSPs)
chr6 (372-410)||(10819231-10819269)
[»] chr1 (1 HSPs)
chr1 (161-202)||(73773-73814)


Alignment Details
Target: chr6 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 410
Target Start/End: Complemental strand, 10819269 - 10819231
Alignment:
372 ggactcaagtatttgcttgagaaacttcgtgaaccctct 410  Q
    |||||||||||||||||||||||||||||||||| ||||    
10819269 ggactcaagtatttgcttgagaaacttcgtgaacactct 10819231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 161 - 202
Target Start/End: Complemental strand, 73814 - 73773
Alignment:
161 cataaccatcattactagttcctatgtggtataatcaaattc 202  Q
    |||||| || ||||||||||||||| ||||||||||||||||    
73814 cataacaattattactagttcctatatggtataatcaaattc 73773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University