View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8435_high_1 (Length: 425)
Name: NF8435_high_1
Description: NF8435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8435_high_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 372 - 410
Target Start/End: Complemental strand, 10819269 - 10819231
Alignment:
| Q |
372 |
ggactcaagtatttgcttgagaaacttcgtgaaccctct |
410 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10819269 |
ggactcaagtatttgcttgagaaacttcgtgaacactct |
10819231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 161 - 202
Target Start/End: Complemental strand, 73814 - 73773
Alignment:
| Q |
161 |
cataaccatcattactagttcctatgtggtataatcaaattc |
202 |
Q |
| |
|
|||||| || ||||||||||||||| |||||||||||||||| |
|
|
| T |
73814 |
cataacaattattactagttcctatatggtataatcaaattc |
73773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University