View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8435_high_6 (Length: 266)
Name: NF8435_high_6
Description: NF8435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8435_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 10571531 - 10571306
Alignment:
| Q |
18 |
tgaaggagtcaagaacgcatcttctggatctggttcggtgaacattgattattgaatacattggatccctatgccattcttttggggtgattgatgtatt |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10571531 |
tgaaggagtcaagaacacatcttctggatctggttcggtgaacattgattattgaatacattggatccctatgccattattttggggtgattgatgtatt |
10571432 |
T |
 |
| Q |
118 |
tctttctttccccttgataatattaatatgctaagtagggaatctcgtcaattttcataggctaataggttattaatttaactataggtctattttcaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10571431 |
tctttctttccccttgataatattaatatgctaagtagggaatctcgtgaattttcataggctaataggttattaatttaactataggtctattttcaat |
10571332 |
T |
 |
| Q |
218 |
tcaattcttatactagtatatatgtt |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
10571331 |
tcaattcttatactagtatatatgtt |
10571306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University