View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8435_low_8 (Length: 240)
Name: NF8435_low_8
Description: NF8435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8435_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 49980839 - 49980737
Alignment:
| Q |
1 |
tcgaaattactagtaatttagttaaatttgattgtgtggtctatttgaaagtccctaaatggatctattttctttggaaagatagtaattgttgagcaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || || |||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
49980839 |
tcgaaattactagtaatttagttaaatttgattgtgtggtctatttgaaggttcccaaatggatctattttctttgaaaagatagtaattgttcagcaac |
49980740 |
T |
 |
| Q |
101 |
tta |
103 |
Q |
| |
|
||| |
|
|
| T |
49980739 |
tta |
49980737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 49980614 - 49980547
Alignment:
| Q |
102 |
tatgtaaaaaataagtggaaatggttttcaggtaaggtaagacttcacggaaaacttgttattatgta |
169 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49980614 |
tatgtaaaaaataagtggaagtggttttcaggtaaggtaagacttcacggaaaacttgttattatgta |
49980547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 167 - 221
Target Start/End: Complemental strand, 49980266 - 49980212
Alignment:
| Q |
167 |
gtatttgaccccatagaggtttgtggtgttgaccaggacggatcggttgtgcata |
221 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49980266 |
gtatttgaccccacagaggtttgtggtgttgaccaggacggatcggttgtgcata |
49980212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University