View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8436_high_10 (Length: 251)
Name: NF8436_high_10
Description: NF8436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8436_high_10 |
 | |
|
| [»] scaffold0016 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0016 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 21 - 107
Target Start/End: Original strand, 46935 - 47021
Alignment:
| Q |
21 |
cggacaaatattatgtacacactaaacaagttacctaacatatgtttcttctatggctgcactgtaatggttcagataaaaagataa |
107 |
Q |
| |
|
|||||||||||||| | ||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46935 |
cggacaaatattatctgcacactaaacaagctgcctaacatatgtttcttctatggctgcactgtaatggttcagataaaaagataa |
47021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 71 - 192
Target Start/End: Complemental strand, 33715095 - 33714973
Alignment:
| Q |
71 |
ctatggctgcactgtaatggttcagataaaaagataaattaacatttccatctataaactcaacgatatgaaaggaaaac-tttttcatgtaacatagcc |
169 |
Q |
| |
|
|||||||||||||| |||||||||| ||||| |||||||||| || |||||||||| |||||| || |||||| ||| | ||||| ||||||||||||| |
|
|
| T |
33715095 |
ctatggctgcactgcaatggttcagttaaaacaataaattaaccttgccatctataagctcaacaatttgaaagtaaacctttttttatgtaacatagcc |
33714996 |
T |
|
| Q |
170 |
atagctctatatactatctacaa |
192 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33714995 |
atagctctatatactatctacaa |
33714973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University