View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8436_high_13 (Length: 221)
Name: NF8436_high_13
Description: NF8436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8436_high_13 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 38926959 - 38927179
Alignment:
| Q |
1 |
caaattctccaacccatcagaatttgataccatagtcctaagtgaacatggagagtaaatagcaacagcttcatcatattcaatgtcaaattgatctaac |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38926959 |
caaattctccaagccatcagaatttgataccatagtcctaagtgaacatggagagtaaatagcaacagcttcatcatattcaatgtcaaattgatctaac |
38927058 |
T |
|
| Q |
101 |
ttaatctccatagcatcctcaacaaaaactatgttatataaaaagggtatgttcaaggattcagcaaaactcattaaacttttgccaatttcttctaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38927059 |
ttaatctccatagcatcctcaacaaaaactatgttatataaaaagggtatgttcaaggattcagcaaaactcattaaacttttgccaatttcttctaact |
38927158 |
T |
|
| Q |
201 |
tagccttgttagaaaatccaa |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38927159 |
tagccttgttagaaaatccaa |
38927179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 134 - 195
Target Start/End: Original strand, 44837613 - 44837674
Alignment:
| Q |
134 |
ttatataaaaagggtatgttcaaggattcagcaaaactcattaaacttttgccaatttcttc |
195 |
Q |
| |
|
|||||||||||||| | |||||| |||||||||||||| |||| |||||||| ||||||| |
|
|
| T |
44837613 |
ttatataaaaagggcaagttcaatgattcagcaaaactagctaaatttttgccagtttcttc |
44837674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University