View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8436_low_13 (Length: 246)
Name: NF8436_low_13
Description: NF8436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8436_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 26 - 222
Target Start/End: Original strand, 25185248 - 25185446
Alignment:
| Q |
26 |
actaatacttcaattcagttggttttgtttgaagtgaaaaagacaaaatgtgat-----cctaatgcaagtgcggcacaaaaattatgctaaagggtccc |
120 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
25185248 |
actaatacttccattcagttggttttctttgaagtgaaaaagacaaaatgtgattttcacctaatacaagtgcggcacaaaaattatgctatagggtccc |
25185347 |
T |
 |
| Q |
121 |
acttggtctaggtgttagaaaatggcactcnnnnnnnnnnnnnngaaagaagaaaatagcactcttatagtcttcttatttgtctatttatcttgttaat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25185348 |
acttggtctaggtgttagaaaatggcactcttttttctttttttgaaagaagaaaatggcactcttatag---tcttatttgtctatttatcttgttaat |
25185444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University