View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8436_low_16 (Length: 213)
Name: NF8436_low_16
Description: NF8436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8436_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 19 - 138
Target Start/End: Complemental strand, 45609319 - 45609200
Alignment:
| Q |
19 |
taagaaacaccctaaacatattcaatcacccggtgtatgttctctttgtttgaaagataagcttgatcaattatccacatcttctagttctagctctcaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45609319 |
taagaaacaccctaaacatattcaatcacgcggtgtatgttctatttgtttgaaagataagcttgatcaattatccacatcttctagttatagctctcaa |
45609220 |
T |
 |
| Q |
119 |
aaaacaacctcatcctgttg |
138 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
45609219 |
aaaacaacctcatcctgttg |
45609200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University