View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8436_low_9 (Length: 309)
Name: NF8436_low_9
Description: NF8436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8436_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 92 - 293
Target Start/End: Complemental strand, 48677628 - 48677421
Alignment:
| Q |
92 |
gagagtgttagaagagtgtgttagagggtgtgtgacccaagcatccctcaaaaataaaaagaaactctgataatttagaataagaaatgttatggtcaca |
191 |
Q |
| |
|
||||||||||||||||| | ||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48677628 |
gagagtgttagaagagtctcttagaggatgtgtgactttagcatccctcaaaaataaaaagaaactctgataatttagaataaaaaatgttatggtcaca |
48677529 |
T |
 |
| Q |
192 |
--cactgacactctcttttaacccacccaattataacctgtgttaacgttta----nnnnnnnnnnattattcattaaatcaggttttcacgtttcatct |
285 |
Q |
| |
|
|||| |||||||||||||| ||||| |||||||||||||||||||||||| |||||| ||||||| ||||||||||||||||||| |
|
|
| T |
48677528 |
tccactaacactctcttttaatccacctaattataacctgtgttaacgtttattttatttttttttattattaattaaataaggttttcacgtttcatct |
48677429 |
T |
 |
| Q |
286 |
tctctgct |
293 |
Q |
| |
|
|||||||| |
|
|
| T |
48677428 |
tctctgct |
48677421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University