View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8437_low_3 (Length: 344)
Name: NF8437_low_3
Description: NF8437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8437_low_3 |
 | |
|
| [»] scaffold1075 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 2 - 333
Target Start/End: Complemental strand, 17006345 - 17006016
Alignment:
| Q |
2 |
cgagcatcaacatggtctttactctttgaactatcgttaagcaaagtatatatgatattatccaacacatttttctcgatgtgcatcgggtcaagattat |
101 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17006345 |
cgagcatcaacatggtctttattctttgaactatcgttaagcaaagtatatatgatattatccaacacatttttctcgatatgcatcgggtcaagattat |
17006246 |
T |
|
| Q |
102 |
gacgcagaagattgtccttccaatatggaagttcaaagaatatgcttttcttcttccagattggagggtcatcttttgtagattgcctcttgcctttccn |
201 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
17006245 |
gacgcaaaagattgtccttccaatatggaagttcaaagaatatgcttttcttcttctagattggagggtcatcttttgtagattgcctcttgcctgtcc- |
17006147 |
T |
|
| Q |
202 |
nnnnnnnnctggtttggagggtcaccttgtgtaggttgtttcttgccttttctttttcccaaccctgctttctttggctttttaccaaaaatgaccttta |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17006146 |
-tttttttctggtttggagggtcaccttgtgtaggttgtttcttgccttttctttttcccaaccctgctttctttggctttttaccaaaaatgaccttta |
17006048 |
T |
|
| Q |
302 |
tgttttcaacctgttcaagaacttgatgtcca |
333 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |
|
|
| T |
17006047 |
tgttttcaacctgttgaagaacttgatgtcca |
17006016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1075 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: scaffold1075
Description:
Target: scaffold1075; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 302
Target Start/End: Original strand, 2751 - 3050
Alignment:
| Q |
1 |
acgagcatcaacatggtctttactctttgaactatcgttaagcaaagtatatatgatattatccaacacatttttctcgatgtgcatcgggtcaagatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2751 |
acgagcatcaacatggtctttactctttgaactatcgttaagcaaagtatatatgatattatccaacacatttttctcgatatgcatcgggtcaagatta |
2850 |
T |
|
| Q |
101 |
tgacgcagaagattgtccttccaatatggaagttcaaagaatatgcttttcttcttccagattggagggtcatcttttgtagattgcctcttgcctttcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2851 |
tgacgcagaagattgtccttccaatatggaagttcaaagaatatgcttttcttcttccagattggagggtcatcttttgtagattgcctcttgcctgtcc |
2950 |
T |
|
| Q |
201 |
nnnnnnnnnctggtttggagggtcaccttgtgtaggttgtttcttgccttttctttttcccaaccctgctttctttggctttttaccaaaaatgaccttt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2951 |
--tttttttctggtttggagggtcaccttgtgtaggttgtttcttgccttttctttttcccaaccctgctttctttggctttttaccaaaaatgaccttt |
3048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University