View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8438_high_12 (Length: 398)
Name: NF8438_high_12
Description: NF8438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8438_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 11 - 380
Target Start/End: Original strand, 3640087 - 3640456
Alignment:
| Q |
11 |
gtgagatgaaaatggggttgaaggtttttaacatggttgttcataaagatgttatttcttggggtactgttatttgtggattggctatgaatgggtatgg |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3640087 |
gtgatatgaaaatggggttgaaggtttttaacatggttgttcataaagatgttatttcttggggtactgttatttgtggattggctatgaatgggtatgg |
3640186 |
T |
 |
| Q |
111 |
taaacaagttgtgcagatgttttcacatatgctggttcatggggttttacctgatgatgtaacgtttattggtttgttgtctgcgtgtagccacgttggt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3640187 |
taaacaagttgtgcagatgttttcacatatgctggttcatggggttttacctgatgatgtaacgtttattggtttgttgtctgcgtgtagccacgttggt |
3640286 |
T |
 |
| Q |
211 |
ttggttagtgagggaatgatgttctttaaagctatgaaagatagttatggcattgtgccgcaaatgagtcattatggttgcatggttgatatgtatggac |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3640287 |
ttggttagtgagggaatgatgttctttaaagctatgagagatagttatggcattgtgccacaaatgagtcattatggttgcatggttgatatgtatggac |
3640386 |
T |
 |
| Q |
311 |
gtgctggtttgtttgaggaagctgtggctttccttaaaggtatgcctgttgaagcggagggacctatttg |
380 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3640387 |
gtgctagtttgtttgaggaagctgtggctttccttaaaggtatgcctgttgaagcggagggacctatttg |
3640456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University