View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8438_high_21 (Length: 321)

Name: NF8438_high_21
Description: NF8438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8438_high_21
NF8438_high_21
[»] chr7 (1 HSPs)
chr7 (1-118)||(2442847-2442964)


Alignment Details
Target: chr7 (Bit Score: 106; Significance: 5e-53; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 2442964 - 2442847
Alignment:
1 tgtggcaatgaacgtttgatagaaaatgtagcaggggttatgaagaacatttagacgatgtagggagcagcttcagtcaaataaattaggttttctatgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||    
2442964 tgtggcaatgaacgtttgatagaaaatgtagcaggggttatgaagaacagtttgacgatgtagggagtagcttcagtcaaataaattaggttttctatgt 2442865  T
101 cataaatcttctataata 118  Q
    ||||||||||||||||||    
2442864 cataaatcttctataata 2442847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University