View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8438_high_25 (Length: 297)
Name: NF8438_high_25
Description: NF8438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8438_high_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 92 - 296
Target Start/End: Original strand, 43586641 - 43586848
Alignment:
| Q |
92 |
cccaaaagtgacagtggaatcggtgatgatgcagcggcgtcgtttcccaaaggacggtgtctatgttcaccaacgacacacgaaggctctttcaggtgtc |
191 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43586641 |
cccaaaagtgacagtggaatcggtggtgatgcagcggcgtcgtttcccaaaggacggtgtctatgttcaccaacgacacacgaaggctctttcaggtgtc |
43586740 |
T |
 |
| Q |
192 |
gttttcatcgttcaaggtcattttcgtcatctgcacctccatcttggatgaaaaggaccaaatcaatgcctcctaatc---ataagtctgttgtctctgc |
288 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
43586741 |
gttttcatcgttcagggtcattttcgtcatctgcacctccaccttggatgaaaaggaccaaatcaatgcctcctaatcataataagtctgttgtttctgt |
43586840 |
T |
 |
| Q |
289 |
ttctccac |
296 |
Q |
| |
|
|||||||| |
|
|
| T |
43586841 |
ttctccac |
43586848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 43586526 - 43586556
Alignment:
| Q |
1 |
tctttcacctccttgattaatggcttcccag |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43586526 |
tctttcacctccttgattaatggcttcccag |
43586556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University