View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8438_high_32 (Length: 252)
Name: NF8438_high_32
Description: NF8438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8438_high_32 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 80 - 252
Target Start/End: Original strand, 526711 - 526883
Alignment:
| Q |
80 |
gttctacgtctgtttctagttgactcaactcaatgatagattaaattgataatcatagaatgaatattttattcttannnnnnnaacattgttagtacct |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
526711 |
gttctacgtctgtttctagttgactcaactcaatgatagattaaattgataatcatagaatgaatattttattcttattttttgaacattgttagtacct |
526810 |
T |
 |
| Q |
180 |
tactgagttactgtcctgcatagtcattaacttttccaattaagtgaccgtaactgtgactgtcaaatacatt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
526811 |
tactgagttactgtcctgcatagtcattaacttttccaattaagtgaccgtaactgtgactgtcaaatacatt |
526883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 44
Target Start/End: Original strand, 526643 - 526675
Alignment:
| Q |
12 |
attattctacgatgattaaacttgaagctgaac |
44 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
526643 |
attattctacgatgattaaacttgaagatgaac |
526675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University