View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8438_high_37 (Length: 238)
Name: NF8438_high_37
Description: NF8438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8438_high_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 107 - 195
Target Start/End: Original strand, 43587051 - 43587139
Alignment:
| Q |
107 |
tataattatgttttgaattgattttcgcaacagttctgttatctactatcaacatgatgatacctaaagcataataacttcgatccatt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43587051 |
tataattatgttttgaattgattttcgcaacagttctgttatctactatcaacatgatgatacctaaagcataataacttcgatccatt |
43587139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 43586911 - 43586969
Alignment:
| Q |
1 |
gtctatgcttatatgttgttaatcgatcattaactacttctttaagcttatgtaaaggttat |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43586911 |
gtctatgcttatatgttgttaatcgatcattaacta---ctttaagcttatgtaaaggttat |
43586969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University