View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8438_high_37 (Length: 238)

Name: NF8438_high_37
Description: NF8438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8438_high_37
NF8438_high_37
[»] chr8 (2 HSPs)
chr8 (107-195)||(43587051-43587139)
chr8 (1-62)||(43586911-43586969)


Alignment Details
Target: chr8 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 107 - 195
Target Start/End: Original strand, 43587051 - 43587139
Alignment:
107 tataattatgttttgaattgattttcgcaacagttctgttatctactatcaacatgatgatacctaaagcataataacttcgatccatt 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43587051 tataattatgttttgaattgattttcgcaacagttctgttatctactatcaacatgatgatacctaaagcataataacttcgatccatt 43587139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 43586911 - 43586969
Alignment:
1 gtctatgcttatatgttgttaatcgatcattaactacttctttaagcttatgtaaaggttat 62  Q
    ||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||    
43586911 gtctatgcttatatgttgttaatcgatcattaacta---ctttaagcttatgtaaaggttat 43586969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University