View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8438_low_27 (Length: 301)

Name: NF8438_low_27
Description: NF8438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8438_low_27
NF8438_low_27
[»] chr2 (3 HSPs)
chr2 (9-142)||(8344440-8344573)
chr2 (219-281)||(8344650-8344712)
chr2 (232-280)||(8344747-8344795)


Alignment Details
Target: chr2 (Bit Score: 126; Significance: 5e-65; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 9 - 142
Target Start/End: Original strand, 8344440 - 8344573
Alignment:
9 tggtggtggtattggcattaatagtggtggaggatacggcaatggtgcagttggtggttcaggtagtggtggagttggtgtaggacctggttctgggggt 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8344440 tggtggtggtattggcattaatagtggtggaggatacggcaatggtgcagttggtggttcaggtagtggtggagttggtgtaggacctggttctgggggt 8344539  T
109 gtagttggaggtgaaaataaccccggaaatagtc 142  Q
    ||||||||||||| | ||||||||||||||||||    
8344540 gtagttggaggtggatataaccccggaaatagtc 8344573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 219 - 281
Target Start/End: Original strand, 8344650 - 8344712
Alignment:
219 tagttttggagggtctggtagtggaggaataggtggtggttatggtgatggaattggaggatc 281  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
8344650 tagttttggagggtctggtggtggaggaataggtggtggttatggtgatggaattggaggatc 8344712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 232 - 280
Target Start/End: Original strand, 8344747 - 8344795
Alignment:
232 tctggtagtggaggaataggtggtggttatggtgatggaattggaggat 280  Q
    |||||| |||||| |||||||||||||||||||| ||||| ||||||||    
8344747 tctggtggtggagcaataggtggtggttatggtggtggaaatggaggat 8344795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University