View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8438_low_27 (Length: 301)
Name: NF8438_low_27
Description: NF8438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8438_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 5e-65; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 9 - 142
Target Start/End: Original strand, 8344440 - 8344573
Alignment:
| Q |
9 |
tggtggtggtattggcattaatagtggtggaggatacggcaatggtgcagttggtggttcaggtagtggtggagttggtgtaggacctggttctgggggt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8344440 |
tggtggtggtattggcattaatagtggtggaggatacggcaatggtgcagttggtggttcaggtagtggtggagttggtgtaggacctggttctgggggt |
8344539 |
T |
|
| Q |
109 |
gtagttggaggtgaaaataaccccggaaatagtc |
142 |
Q |
| |
|
||||||||||||| | |||||||||||||||||| |
|
|
| T |
8344540 |
gtagttggaggtggatataaccccggaaatagtc |
8344573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 219 - 281
Target Start/End: Original strand, 8344650 - 8344712
Alignment:
| Q |
219 |
tagttttggagggtctggtagtggaggaataggtggtggttatggtgatggaattggaggatc |
281 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8344650 |
tagttttggagggtctggtggtggaggaataggtggtggttatggtgatggaattggaggatc |
8344712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 232 - 280
Target Start/End: Original strand, 8344747 - 8344795
Alignment:
| Q |
232 |
tctggtagtggaggaataggtggtggttatggtgatggaattggaggat |
280 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||| ||||| |||||||| |
|
|
| T |
8344747 |
tctggtggtggagcaataggtggtggttatggtggtggaaatggaggat |
8344795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University