View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8439_high_12 (Length: 272)
Name: NF8439_high_12
Description: NF8439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8439_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 8 - 258
Target Start/End: Complemental strand, 34270785 - 34270535
Alignment:
| Q |
8 |
tatggaggtgcagtagggagaatatgaaaaattacggaatacaccttctcgtactctcgcacgtcttttcaatgcccaaattaaagcaaaggtgcactgt |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34270785 |
tatgcaggtgcagtagggagaatatgaaaaattacggaatacacctcctcgtactctcgcacgtcttttcaatgcccaaattaaagcaaaggtgcactgt |
34270686 |
T |
 |
| Q |
108 |
tgacttgatccaattcatgaccacagggaatgtggtggacgtgttgcacttggctaagctttgtgatgcaccaaatctctacttcaggtgtgtcaagtta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34270685 |
tgacttgatccaattcatgaccacagggaatgtggtggacgtgttgcacttggctaagctttgtgatgcaccaaatctctacttcaagtgtgtcaagtta |
34270586 |
T |
 |
| Q |
208 |
gttaccaataatttcgaagcggtgaaagaaacagaggggtggaaattattg |
258 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34270585 |
gttaccaataattttgaagcggtgaaagaaacagaggggtggaaattattg |
34270535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University