View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8439_high_15 (Length: 247)
Name: NF8439_high_15
Description: NF8439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8439_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 82 - 237
Target Start/End: Complemental strand, 175798 - 175643
Alignment:
| Q |
82 |
aaattgagcgtgaggcgggttttactgaaatatggaatgggaaatgagtgcttcgttgttacagaatttgaagttacacgatccatggcttcctccaaac |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
175798 |
aaattgagcgtgaggcgggttttactgaaatatggaatgggaaatgagtgcttcgttgttacagaatttgaagttacacgatccatggcttcctccaaac |
175699 |
T |
 |
| Q |
182 |
acttgggaacaacgaacacaaacaccccttcttcctcttcaattatcttcaaattc |
237 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
175698 |
acttgggaacaacgaacaccaacaccccttcttcctcttcaattatcttcaaattc |
175643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 175833 - 175794
Alignment:
| Q |
1 |
gtgagtgacatggagtaaagtaaagttgttcttgcaaatt |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
175833 |
gtgagtgacatggagtaaagtaaagttgttcttgcaaatt |
175794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University