View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8439_low_22 (Length: 208)
Name: NF8439_low_22
Description: NF8439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8439_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 21310570 - 21310771
Alignment:
| Q |
1 |
catgctttagcatccacataaagtgccgaactctctcactaacacttgctcatcactaccatttgcttcatttggaggaagaatggcagctatcttcctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21310570 |
catgctttagcatccacataaagtgccgaactctctcactaacacttgcatatcactaccatttgcttcatttggaggaagaatggcagctatcttcctt |
21310669 |
T |
 |
| Q |
101 |
ttgatatcatttggtaaccaatcacctaaaatttgccaatttcactcaccatttgaatcaacaagatcaaatactttggcttcccataattcctgtggta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
21310670 |
ttgatatcatttggtaaccaatcacctaaaatttgccaatttcactcaccatttgaatcaacaagatcacatactttggcttcccataattcctgcggta |
21310769 |
T |
 |
| Q |
201 |
ct |
202 |
Q |
| |
|
|| |
|
|
| T |
21310770 |
ct |
21310771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University