View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8439_low_5 (Length: 378)
Name: NF8439_low_5
Description: NF8439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8439_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 7e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 115 - 360
Target Start/End: Complemental strand, 39555609 - 39555363
Alignment:
| Q |
115 |
gacaacttttcaattgtcaaaataattttctttcttcttattagtaaactatattaatcttcaaagtttgaatttgaatcttcaaattagctctatttaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| || |||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |||| |
|
|
| T |
39555609 |
gacaacttttcaattgtcaaaataatttttttt-ttattattagtaaactatattaatcttcaaattttgaatttgaatcttcaaatgagctctttttag |
39555511 |
T |
|
| Q |
215 |
aagnnnnnnnnnnnnnnn--gtggtggtcggggttcgaatctcatgccatacatatattatcattcttcttatcaattgagttaaacttacgatgactct |
312 |
Q |
| |
|
||| ||||||||||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39555510 |
aagtatctttttttttttttgtggtggtcggggttcgaacctcataccatacatatattatcattctccttatcaattgagttaaacttacgatgactct |
39555411 |
T |
|
| Q |
313 |
ttttcaaagtatcttagcacaccatatatgatgctgcttgggacatat |
360 |
Q |
| |
|
||||| |||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39555410 |
ttttcgaagtattttagcacaccatatatggtgctgcttgggacatat |
39555363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 8 - 50
Target Start/End: Complemental strand, 39555710 - 39555668
Alignment:
| Q |
8 |
ttaagagaatccatttgaaccaaaatgtgtcaactttaaagac |
50 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39555710 |
ttaagagaatccatttcaaccaaaatgtgtcaactttaaagac |
39555668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University