View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8440_high_13 (Length: 213)

Name: NF8440_high_13
Description: NF8440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8440_high_13
NF8440_high_13
[»] chr6 (1 HSPs)
chr6 (44-201)||(6727031-6727188)


Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 44 - 201
Target Start/End: Original strand, 6727031 - 6727188
Alignment:
44 taatgagtagtaaattaaaaattataagaatcaaataagacaacaaaatcactcttccaatacattttcttttgggggaaaaacgaaatataaaatgtga 143  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
6727031 taatgagtagtaaattaaaaattataagaatcaaataagacaacaaaatcactcttccaatacattttcttttgggggaaaaccgaaatataaaatgtga 6727130  T
144 tgattgctaccttgaagcagtgatatttttgcatggctcgcttccacctctctctgct 201  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
6727131 tgattgctaccttgaagcagtgatatttttgcatggctcgcttccacctccctctgct 6727188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University