View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8440_low_1 (Length: 798)
Name: NF8440_low_1
Description: NF8440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8440_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 2e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 2e-63
Query Start/End: Original strand, 598 - 721
Target Start/End: Original strand, 27774611 - 27774734
Alignment:
| Q |
598 |
ttctagttgttagctttactaattatatataactattacctcacaacctgaaatttgtgcgtcagcagaacaaagacaatatataaagccggcatttggg |
697 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27774611 |
ttctagttgttagctttactaattatatataactattacctcacaacctgaaatttgtgcgtcagcagaacaaagacaatatataaagccggcatttggg |
27774710 |
T |
|
| Q |
698 |
aggcagaggggaacaaggtcttgg |
721 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
27774711 |
aggcagaggggaacaaggtcttgg |
27774734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 81 - 138
Target Start/End: Original strand, 27767576 - 27767633
Alignment:
| Q |
81 |
gatatttgatggctataagaatgtgatacccctttttgattctctatcacaaatttct |
138 |
Q |
| |
|
||||||||||||||||| |||| |||||| || |||||||||||||| ||||||||| |
|
|
| T |
27767576 |
gatatttgatggctatatgaatatgatacgccattttgattctctatttcaaatttct |
27767633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 5e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 43803113 - 43803066
Alignment:
| Q |
18 |
attctcattactcaattatggaaagtacaagatgtatatatacatgaa |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43803113 |
attctcattactcaattatggaaagtacaagatgtatatatacatgaa |
43803066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University