View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8440_low_15 (Length: 278)

Name: NF8440_low_15
Description: NF8440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8440_low_15
NF8440_low_15
[»] chr3 (1 HSPs)
chr3 (5-262)||(7744464-7744721)


Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 5 - 262
Target Start/End: Complemental strand, 7744721 - 7744464
Alignment:
5 cggacacaacattaacaccgacacatagacatcgtcatcagtaatgatttggaaaatggaagtactgattacaaccacatgtatagttattggataccaa 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7744721 cggacacaacattaacaccgacacatagacatcgtcatcagtaatgatttggaaaatggaagtactgattacaaccacatgtatagttattggataccaa 7744622  T
105 caacgtgtcatataccagatacgccttcgatcatctagtacagctcagattcaactgcatgcacattgttactgtacttgacctagaacaaaaggatgtt 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7744621 caacgtgtcatataccagatacgccttcgatcatctagtacagctcagattcaactgcatgcacattgttactgtacttgacctagaacaaaaggatgtt 7744522  T
205 tcatggaggaatatgagagtatcctacatagtagtacctgtgccactttatagacttg 262  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7744521 tcatggaggaatatgagagtatcctacatagtagtacctgtgccactttatagacttg 7744464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University