View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8440_low_16 (Length: 273)
Name: NF8440_low_16
Description: NF8440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8440_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 44100745 - 44101011
Alignment:
| Q |
1 |
gtcacagattggagcagagtttgtaggaacgttcatattaatatatgcagcaacagcaggaccaatagtgaacaacaaatacaatggagtagaaactctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44100745 |
gtcacagattggagcagagtttgtaggaacgttcatattaatatatgcagcaacagcaggaccaatagtgaacaacaaatacaatggagtagaaactctt |
44100844 |
T |
|
| Q |
101 |
atgggaaatgcagcttgtgctggattaacggtcatgttcattattctctcaattggtcatatctcaggtgcacatctcaatccatcactcaccattgcct |
200 |
Q |
| |
|
|||||||||||||||||||||||| | || ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44100845 |
atgggaaatgcagcttgtgctggactgacagtcatgttcattattctctcaattggtcatatctcaggtgctcatctcaatccatcactcaccattgcct |
44100944 |
T |
|
| Q |
201 |
tcgcggcatttcgccattttccatgggcacatgttccagcctacattgcagcacaagtctctgcttc |
267 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44100945 |
tcgcggcatttcgccattttccctgggcacatgttccagcctacattgcagcacaagtctctgcttc |
44101011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University