View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8440_low_17 (Length: 221)
Name: NF8440_low_17
Description: NF8440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8440_low_17 |
 |  |
|
| [»] scaffold0140 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0140 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 36637 - 36434
Alignment:
| Q |
1 |
ccattttggtgcattttggtatgaaagaagacaattatgtctacaactttgctaactataatcatattactttaacagtgaatcacaaagtaatgaacaa |
100 |
Q |
| |
|
|||||||||||||||||| ||||||| |||| ||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36637 |
ccattttggtgcattttgctatgaaacaagataattatgactacaactttgcttactataatcatattactttaacagtgaatcacaaactaatgaacaa |
36538 |
T |
 |
| Q |
101 |
gcagacaacaatagcatgacaaacaaacttcatttcatttattcaagaaacacaacttcttttcattacaatcaacaatgtcataaacttcataacattg |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36537 |
gcatacaacaatagcatgacaaacaaacttcatttcattgattcaagaaacacaacttcttttcattacaatcaacaatgtcataaacttcataacattg |
36438 |
T |
 |
| Q |
201 |
attt |
204 |
Q |
| |
|
|||| |
|
|
| T |
36437 |
attt |
36434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University