View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8441_low_19 (Length: 250)
Name: NF8441_low_19
Description: NF8441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8441_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 16 - 237
Target Start/End: Original strand, 2570791 - 2571012
Alignment:
| Q |
16 |
attatatcacaaagcactcacacaagctctaatatgttggaataaagcaccgagttaatatgcttgaatgaaacttaaccttgaggaattttttatttgc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2570791 |
attatatcacaaagcactcacacaagctctaatatgttggaataaagcaccgaattaatatgcttgaatgaaacttaaccttgaggaattttttatttgc |
2570890 |
T |
|
| Q |
116 |
tttatctagcttgcaatgtcaagtggttaggactacgggggcatgatctacccatgctgcctgatcaatctttcgttccattgaagacaaaggacctaca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2570891 |
attatctagcttgcaatgtcaagtggttaggactacgggggcatgatctacccatgctgcctgatcaatctttcgttccattgaagacaaaggacctaca |
2570990 |
T |
|
| Q |
216 |
aattgctcaaagcttgatgtcc |
237 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2570991 |
aattgctcaaagcttgatgtcc |
2571012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University