View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8441_low_23 (Length: 220)
Name: NF8441_low_23
Description: NF8441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8441_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 29 - 204
Target Start/End: Complemental strand, 47711521 - 47711346
Alignment:
| Q |
29 |
ggggattagaataaccagtacgtaccctttaaaagaaacaagaatttgaagcaaagttcaagaaaatttctaacgcttgtgatgttcttgttgaccccaa |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47711521 |
ggggattagaataaccagtacgtaccctttaaaagaaacaagagtttgaagcaaagttcaagaaaatttctaacgcttgtgatgttcttgttgaccccaa |
47711422 |
T |
|
| Q |
129 |
gaagagtcaattctatgacctcaatggtcaatatccacttaactcttaacgcttcaatgatgaaaatggtgatggg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47711421 |
gaagagtcaattctatgacctcaatggtcaatatccacttaactcttaacgcttcaatgatgaaaatggtgatggg |
47711346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University