View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8441_low_24 (Length: 218)
Name: NF8441_low_24
Description: NF8441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8441_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 19 - 195
Target Start/End: Original strand, 769449 - 769635
Alignment:
| Q |
19 |
attatacttatcaataagttaccacttgagtttctcaaaccaaaaagaaaataaagtcagc---tcttgagtcattatctcgtctattgataaacataaa |
115 |
Q |
| |
|
|||||| ||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
769449 |
attatatttatcaagaagttagcacttgagtttctcaaaccaaaaagaaaataaagtcagcagctcttgagtcattatctcgtctattgataaacataaa |
769548 |
T |
|
| Q |
116 |
tggcatacaagtatatagctcatggcct-------nnnnnnncaattaaataaaaattaggcagcgcatggcctcaaatgctgaaac |
195 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
769549 |
tggcatacaagtatatagctcatggcctaaaaaaaaaaaaaacaattaaataaaaattaggcagcgcatggcctcaaatgctgaaac |
769635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University