View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8441_low_8 (Length: 431)
Name: NF8441_low_8
Description: NF8441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8441_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 142 - 415
Target Start/End: Complemental strand, 14692929 - 14692644
Alignment:
| Q |
142 |
ggatttcttcaaaattgggaaatctgaacattgtaagtaatctgtgcattgccgatggggattttgttgttatgtgaatctggtttgtgcattgcaaatt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
14692929 |
ggatttcttcaaaattgggaaatctgaacattgtaagtaatctgtgcattgccgatggggattttgttgttatgtgtatctggtttgtgcattgccgatt |
14692830 |
T |
 |
| Q |
242 |
tgaatttcattgagtcatgttttaaagttttgagcgtcacactatgcatgaaactgaaatgtaagcatatgcttcttagatagccttttattctttcgat |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14692829 |
tgaatttcattgagtcatgttttaaagttttgagcgtcacactatgcatgaaactgaaatgtaagcatatgcttcttagatagccttttattctttcgat |
14692730 |
T |
 |
| Q |
342 |
tatatcgaagatactattggtttttgaataaaccattaatt------------tatcaccctttattcaatttagtattaaatatg |
415 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14692729 |
tatatcgaagatactattggtttttgactaaaccatcaatttagtttctaaactatcaccctttattcaatttagtattaaatatg |
14692644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 26 - 106
Target Start/End: Complemental strand, 14693039 - 14692959
Alignment:
| Q |
26 |
atgaacaaacccctcctgattcgcctcaatctgctaatcaccgaacatcaaggtaattcaaaaacacaaatcaataactct |
106 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14693039 |
atgaaccaacccctcctgattcgcctcaatctgctaatcaccgaacatcaaggtaattcaaaaacacaaatcaataactct |
14692959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 317 - 365
Target Start/End: Complemental strand, 12124232 - 12124184
Alignment:
| Q |
317 |
ttagatagccttttattctttcgattatatcgaagatactattggtttt |
365 |
Q |
| |
|
||||||||||||||||||||| ||||| ||| ||| ||||||||||||| |
|
|
| T |
12124232 |
ttagatagccttttattctttagattagatccaaggtactattggtttt |
12124184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University